Biomedical Application#

author: “Snit Sanghlao”

The following is note taking for applications for Bioinformatics.

BLAST#

BLAST (basic local alignment search tool)[3] is an algorithm and program for comparing primary biological sequence information, such as the amino-acid sequences of proteins or the nucleotides of DNA and/or RNA sequences.

BLAST

Allocate resource for testing#

To test an example on a compute node

$ salloc -t 1:0:0 -c 32 --mem=64GB
$ ssh <allocated node>

Making example file#

$ printf ">NR_024570.1 Escherichia coli strain U 5/41 16S ribosomal RNA, partial sequence
AGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAACAGGAAGCAGCTTGCTGCTTTGCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGCACAAAGAGGGGGACCTTAGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGA
>NR_169460.1 Pseudomonas aylmerensis strain S1E40 16S ribosomal RNA, partial sequence
CTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAGCGGTAGAGAGAAGCTTGCTTCTCTTGAGAGCGGCGGACGGGTGAGTAATGCCTAGGAATCTGCCTGGTAGTGGGGGATAACGTTCGGAAACGGACGCTAATACCGCATACGTCCTACGGGAGAAAGCAGGGGACCTTCGGGCCTTGCGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTGGTGGGGTAATGGCTCACCAAGGCGACGATCCGTAACTGGTCTGAGAGGATGATCAGTCACACTGGAACTGA
" > refs.fa



$ printf ">Q1
AGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAACAGGAAGCAGCTTGCGGGGGTGCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGCACAAAGAGGGGGACCTTAGGGCCTCTTGCCCCCCCATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGA
>Q2
CTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAGCGGTAGAGAGAAGCTTGCTTCTCTTGAGAGCGGCGGACCCCCGAGTAATGCCTAGGAATCTGCCTGGTAGTGGGGGATAACGTTCGGAAACGGACGCTAATACCGCATACGTCCTACGGGAGAAAGCAGGGGACCTTCGGGCCTTGCGCTATCAGATGAGGGGGGGTCGGATTAGCTAGTTGGTGGGGTAATGGCTCACCAAGGCGACGATCCGTAACTGGTCTGAGAGGATGATCAGTCACACTGGAACTGA
>Q3_exact
AGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAACAGGAAGCAGCTTGCTGCTTTGCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGCACAAAGAGGGGGACCTTAGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGA
>Q4_exact
CTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAGCGGTAGAGAGAAGCTTGCTTCTCTTGAGAGCGGCGGACGGGTGAGTAATGCCTAGGAATCTGCCTGGTAGTGGGGGATAACGTTCGGAAACGGACGCTAATACCGCATACGTCCTACGGGAGAAAGCAGGGGACCTTCGGGCCTTGCGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTGGTGGGGTAATGGCTCACCAAGGCGACGATCCGTAACTGGTCTGAGAGGATGATCAGTCACACTGGAACTGA
" > queries.fa

Blasting#

To run blast tools in singularity container with specific command blastn

$ singularity exec /app/blast.2.11.sif blastn -query queries.fa -subject refs.fa -outfmt "6 qseqid qlen sseqid slen length pident evalue bitscore" -max_hsps 1 -max_target_seqs 1 | sort -nrk 8 > blast-results.tmp

Typically we want things in table form, here’s one way to run it for that and sort by bitscore: Adding a header

$ cat <(printf "qseqid\tqlen\tsseqid\tslen\tlength\tpident\tevalue\tbitscore\n") blast-results.tmp > blast-results.tsv


$ rm blast-results.tmp
$ column -ts $'\t' blast-results.tsv

Reproducting research results with Python and Conda Package management#

In many cases, researcher need system adminstrators to install new library for their project. This is somehow taking longer time then we expected. So one solution in sharing system cluster, we are learing how to use ‘module’ system environment or singularity container. They are general usage. For Python eco-system, conda package management and conflict library resolver save us a lot when it comes to customization library for us.

We use newly release(two years) and request from user for PSSMPRO.

How to#

Setup Conda (once time setup)

$ module load anaconda3

$ conda init bash

Then logout and relogin again.

Create Conda Environment(one time only)

$ conda create -n bio python=3.9 scikit-learn pandas jupyter blast bioconductor-kebabs=1.24.0 -c conda-forge -c bioconda

Wait….!

Activate environment when you want to work on project environment

  $ conda env list

  $  conda activate bio


Add new library to Working Environment
$ pip install pssmpro

$ jupyter notebook

In side your notebook your can verify that you can work with new installed package

from pssmpro.features import create_pssm_profile

Nextflow:Reproducible scientific workflows#

Scientific workflow engines,nextflow are particularly useful for data-intensive domains including bioinformatics and radioastronomy, where data analysis and processing is made up of a number of tasks to be repeatedly executed across large datasets. The following guide is example the of combination of container and workflow engines can be very effective in enforcing reproducible, portable, scalable science. Run a workflow using Singularity and Nextflow ———————————————

Load repository :

~/nextflow/test$ git clone https://github.com/nextflow-io/rnaseq-nf.git

$ cd /home/snit.san/nextflow/test/rnaseq-nf


$ module load slurm

$ salloca –t 1:0:0 –gres=gpu:1

$ ssh <compute_node>

$ module load singularity

$ module load nextflow

$ nextflow run main.nf -profile singularity

Run Nextflow core or nf-core AlphaFold2 workflow#

What ever AlphaFold3 will change the way research working on protein folding and challenging AutoDock, how to run AlphaFold2 with workflow is noted as follow.

$ module load slurm

$ salloca –t 1:0:0 –gres=gpu:1

$ ssh <compute_node>

$ module load singularity

$ module load nextflow

Load repository :

$ cd ~/nextflow/

$ git clone nf-core/proteinfold.git

$ cd rproteinfold

$ unset https_proxy

$ nextflow run nf-core/proteinfold –input ./assets/samplesheet.csv –outdir ./output –mode alphafold2 base –full_dbs false –alphafold2_model_preset monomer –use_gpu true -profile singularity

Reference:

Command-line blast example

Generate PSSM profiles for protein sequences

Thioesterases based on ensemble learning Containers on HPC and Cloud with Singularity